Report Results

Results:

A genome library was created on the plate containing Escherichia coli cells infected with λ-phage containing inserts of genomic Bactrocera dorsalis DNA. A bacterial lawn covered the agar surface, and 45 plaques were observed, as well as two short fingers of no bacterial growth (see Figure 1a).

The plate of cultured E. coli cells containing recombinant DNA plasmids (pUC19 vector with ligated B. dorsalis DNA) produced 476 small circular blue colonies and 512 small circular white colonies. Often the colonies were confluent (Figure 1c).

The agarose gel electrophoresis containing restriction-enzyme-digested DNA samples contained many bands (Figure 2). Lanes 1 and 13 contained 1-kbp DNA marker. Lane 2 (control, pUC19 vector with EcoR1) showed a band at Rf 0.325, lane 3 (BamHI), lane 4 (HindIII), and lane 7 (XhoI) showed bands at Rf 0.125. Lane 5 (Pst1) showed bands at Rf 0.20 and 0.26. Lane 6 (EcoR1) showed bands at Rf 0.175 and 0.325. Lane 8 (EcoR1, XhoI) showed bands at Rf 0.20, 0.325, and 0.613. Lane 9 (HindIII, Pst1) showed bands at Rf 0.20, 0.325, and 0.80. Lane 10 (XhoI, Pst1) showed bands at Rf 0.188, 0.363, and 0.613. Lane 11 (EcoR1, HindIII) showed bands at Rf 0.188, 0.325, and 0.80. Lane 12 (EcoR1, Pst1) showed bands at Rf 0.263, 0.325, and 0.40. The corresponding fragment sizes were used to construct a restriction enzyme map of the plasmid (see Figure 3a). The initial 720-bp nucleotide sequence was searched for restriction enzyme digestion sites using web-based New England BioLabs NEB cutter bioinformatic analysis (see Figure 4).

Following incubation, the Southern blot containing recombinant Bactrocera dorsalis DNA and the control (pUC19 plasmid vector only) were observed. Blue coloration, which indicates positive hybridization of the DIG-UTP probe, was observed in the recombinant DNA blot. No coloration, which indicates no hybridization of the DIG-UTP probe, occurred in the control blot (Figure 5).

The web-based design software Primer3 (http://frodo.wi.mit.edu/) revealed a forward primer of ACTGCCAAAATGTGTGACGA and a reverse primer of TTCTGACCCATACCCACCAT. The segment between primers was 161 base pairs. Following gel electrophoresis of the amplified products of PCR, DNA was observed in lanes 3, 5, 9, and 11 of the 2% agarose gel as bright, high-concentration bands approximately positioned at an Rf-value of 0.77. They can clearly be seen to have similar migration distances, which are all between the 200-bp and 100-bp markers present in lane 7 (standard eGel marker). The negative control samples (containing 0.5 µl of sterile H2O in place of the experimental DNA sequence) in lanes 4, 6, 8, and 10 produced no distinct bands (see Figure 6).