Report Procedure

Materials and Methods:

Previously, isolated genomic DNA from Bactrocera dorsalis was treated with the restriction enzyme EcoRI, and the resultant fragments were ligated into the EMBL3 enterobacteria phage λ vector.

5 μl of this λ-phage solution and 95 μl buffer (NaCl and Mg2+) were added to 200 μl of Escherichia coli host culture suspended in MgSO4. The sample was incubated at 37ºC for 20 minutes. Following incubation, the sample was mixed with 50ºC warm top agar and plated onto fresh nutrient agar. After hardening, the plate culture was incubated at 37ºC for 72 hours.

One plaque from the resultant genome library was selected, and the recombinant DNA (EMBL3 backbone with B. dorsalis genomic DNA insert) was recovered, amplified, and treated with EcoRI to isolate the genomic DNA insert segment. Additionally, 2 μl of pUC19 plasmid vector was treated with EcoRI. 2 μl (100 ng) of isolated genomic DNA insert was ligated into 2 μl (100 ng) pUC19 plasmid vector using 1 μl of DNA ligase enzymes, in 2 μl buffer and 14 μl distilled water. The mixture was incubated at 20ºC for 5 minutes, and then chilled on ice. 10 μl of the reaction mixture was added to 40 μl of competent E. coli cells. The cells were incubated on ice for 30 minutes, heat shocked for 40 seconds in a 37ºC water bath, and returned to ice incubation for 2 minutes. Following incubation, 950 μl of LB broth was added, and the culture was incubated for 35 minutes at 37ºC. Following incubation, 75 μl of the cell culture was plated on selective solid LB agar containing Xgal and ampicillin and incubated for 24 hours at 37ºC.

Following incubation, one colony was selected to create a restriction enzyme map of the recombinant DNA plasmid. Five single enzyme digests and five double enzyme digests were performed on the recombinant DNA plasmid (pUC19 plasmid vector and the insert DNA from Bactrocera dorsalis). For the single enzyme digests, 1 μl of the restriction enzymes BamHI, HindIII, Pst1, EcoRI, and Xho1 each were added to separate preparations containing 5 μl recombinant plasmid DNA, 2 μl buffer solution, and 12 μl distilled H2O. For the double enzyme digests, five enzyme combinations were selected: EcoRI with Xho1, HindIII with Pst1, Xho1 with Pst1, Eco RI with HindIII, and EcoRI with Pst1. 1 μl of each enzyme was added to their respective preparations containing 5 μl of recombinant plasmid DNA, 2 μl of buffer solution, and 11 μl distilled H2O. A control containing only EcoRI and the pUC19 plasmid vector was also prepared. The 11 samples were incubated and electophoresed for 30 minutes at 90 volts in 1.0% agarose gel containing ethidium bromide.

A Southern blot of the recombinant plasmid DNA was prepared. Two samples of DNA (5 µl), the recombinant plasmid DNA (pUC19 with Bactrocera dorsalis genomic DNA insert) and a negative control (pUC19 without insert), were linearized by treatment with the restriction enzyme BamHI. The samples were denatured with 10 µl of denaturing solution (0.3 M NaOH) and incubated at 65º C for 30 minutes. Following incubation, each sample (15 µl) was dotted onto a nylon membrane and cross-linked with UV radiation for 2 minutes. After irradiation, the membrane was placed into a sealable plastic bag. 5 ml of prehybridization solution and the denatured DIG-UTP probe were added, and the sample was incubated for 24 hours. After incubation, the membrane was washed for two 5-minute cycles with 2xSSC, 0.1% SDS at 20ºC, and two 10-minute cycles with 0.5xSSC, 0.1% SDS at 55ºC. The membrane was rinsed in buffer 1 for one minute, and then incubated in a blocking solution, for 20 minutes. The membrane was placed in a bag containing enzyme-conjugated (alkaline phosphatase) anti-DIG antibody solution, and incubated at 20ºC for 25 minutes with agitation. The membrane was washed for two 10-minute cycles with buffer 1. Buffer 3 was added for two minutes and then discarded. The color detection (NBT) solution was added, and the membrane was incubated in darkness at 20ºC for 15 minutes.

A sample of the recombinant plasmid was treated with Pst1 restriction enzyme creating two linear segments. The segment containing only B. dorsalis DNA was sequenced up to 720 base pairs. Primers selected for this sequence, using Primer3 (http://frodo.wi.mit.edu/) design software, were ACTGCCAAAATGTGTGACGA (forward primer) and TTCTGACCCATACCCACCAT (reverse primer). 0.5 µl of the 720-bp segment of B. dorsalis DNA was added to 24.5 µl of PCR amplification reaction (rxn) mixture, which contained 2.5 µl PCR buffer (10X), 17.75 µl distilled H2O, 0.5 µl dNTP mix, 2.5 µl MgCl2 (1.5 mM), 0.5 µl of forward primer (20 pmol), 0.5 µl of reverse primer (20 pmol), and 0.25 µl of Taq polymerase. A negative control was also created by adding 0.5 µl H2O to another vial containing 24.5 µl of PCR rxn mix (noted above). The experimental sample and the control sample were placed into the BioRad Thermocycler, which produced 30 cycles of the following temperature sequence: 1-minute denaturation stage at 94ºC, 30-second annealing stage at 55ºC, 1-minute extension stage at 72ºC. The initial denaturation stage was 2 minutes at 94ºC, and the final extension stage was 7 minutes at 72ºC. Following amplification, both samples were electrophoresed in 2% agarose gel containing ethidium bromide for 30 minutes at 90 volts.